Sept. 23, 2022, 4:25 p.m. by rxsecureweb12
Biological Motivation
Soma (carisoprodol) is a skeletal muscle relaxant that works to relieve muscle pain, and can help ease the feelings of joint or muscular aches. It's available in pill layout and taken by way of mouth three occasions each day, before retiring at night. Soma is used along with other medication to relax spasms.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
