Suggested problems

Biological Motivation

Khoai sọ là một loại khoai rất quen thuộc và được chế biến thành nhiều món ăn ngon như món canh, món bánh,… rất dân dã, ngon miệng, bùi thơm và hấp dẫn. Để hiểu rõ hơn khoai sọ là khoai gì và các tác dụng của khoai sọ, mời bạn hãy theo dõi ngay bài viết dưới đây trong chuyên mục Mẹo vào bếp nhé. [enter link description here][1]

...

[1]: https://www.khoeplus24h.vn/khoai-so-la-khoai-gi-co-phai-la-khoai-mon-khong-tac-dung-cua-khoai-so-642/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21