Suggested problems

Order Zolpidem Online Overnight Delivery | Us Web Medicals

Sept. 23, 2022, 9:31 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Zolpidem is the generic name for Ambien and is classified as a sedative-hypnotic that helps you sleep. It is prescribed to patients diagnosed with insomnia. You can Buy Zolpidem Online in the available doses of 5mg and 10mg. The common side effects caused by Zolpidem are drowsiness, dizziness, and daytime sleepiness. Zolpidem is a treatment drug for insomnia. The common side effects caused by Zolpidem are drowsiness, dizziness, sleepwalking, and sore throat. You can Buy Zolpidem Online in the available doses of 5mg and 10mg

https://uswebmedicals.com/product-category/buy-zolpidem-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21