Suggested problems

Order Fioricet Online Overnight Delivery | Trusted Pharmacy

Sept. 22, 2022, 11:34 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

The Fioricet is a prescription drug combination. It contains acetaminophen, butalbital and caffeine. Every tablet of Fioricet contains 50 mg of butalbital, 40 mg of caffeine and 325 mg of acetaminophen. Acetaminophen is a pain reliever that works through pain management. Butalbital is a drug that belongs to the barbiturates class of drugs that aids in relaxing muscle contraction associated with tension headaches and caffeine: This drug substance relaxes blood vessel muscle contractions to improve blood flow so that it can carry almost all essential nutrients and oxygen efficiently throughout the body. The combined effect of these three ingredients together produces a fast-acting relief from headache pain without the side effects associated with other medicines used for the same purpose.

https://trustedpharmacy247.com/product-category/buy-fioricet-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21