Suggested problems

Order XANAX Online Overnight Delivery | Us Web Medicals

Sept. 22, 2022, 11:29 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Xanax is the brand name for Alprazolam and is administered to treat anxiety and panic disorder. It is a benzodiazepine that selectively blocks nerve cells from sending or receiving chemical signals Xanax is a drug that works to relieve symptoms of anxiety and panic. It works by reducing the overactivity in the brain to calm you down. You can Buy Xanax Online and it will be shipped discreetly to your home address

https://uswebmedicals.com/product-category/buy-xanax-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21