Suggested problems

Order Klonopin Online Overnight Delivery | Trusted Pharmacy

Sept. 22, 2022, 11:24 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Buy Klonopin Online Pharma, Before start taking this medication, read the medication guide carefully. Take this medication as per your preference or as directed by your pharmacists. After you take the medication, do not take any other medicines without a proper prescription from the doctor.

https://trustedpharmacy247.com/product-category/buy-klonopin-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21