Suggested problems

Vitamin tổng hợp là gì? Top 12 loại vitamin tổng hợp tốt cho nam giới

Sept. 21, 2022, 3:37 a.m. by KHOEPLUS24h Sức khỏe thể thao dinh dưỡng bí quyết sống khỏe

Biological Motivation

Vitamin tổng hợp giúp cơ thể cải thiện sức khỏe toàn diện và ngăn ngừa một số bệnh mãn tính xảy ra. Vậy vitamin tổng hợp là gì? Và hãy dành chút thời gian cùng Khoeplus24h tìm hiểu thêm top 12 loại vitamin tổng hợp tốt cho nam giới hiện nay ra sao trong chuyên mục Sức khoẻ dinh dưỡng qua đường link sau nhé: [enter link description here][1]

...

[1]: https://www.khoeplus24h.vn/vitamin-tong-hop-la-gi-top-12-loai-vitamin-tong-hop-tot-cho-nam-gioi-636/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21