Sept. 20, 2022, 11:29 a.m. by usmeds12
Biological Motivation
Oxycodone is an opioid pain medication that works on the opioid receptors in the central nervous system, disrupting the way nerves signal pain between the brain and body. It's used to treat moderate to severe pain and its primary benefit over other types of opioid painkillers is its long-lasting action that can last up to 12 hours.
https://legitpills.com/product-category/buy-oxycodone-online/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
