Suggested problems

Định cư tại Canada theo diện tay nghề

Sept. 19, 2022, 2:05 p.m. by Định cư Canada ALLY

Biological Motivation

Tham khảo chi tiết các thông báo về diện Skilled worker dành cho tất cả công dân có trình độ, tay nghề toàn cầu sẽ được sinh sống, phát triển tại Canada nếu như đáp ứng đủ ngoại ngữ (IELTS) và điều kiện kinh nghiệm tay nghề, sở hữu giấy phép lao động.

Tham khảo thêm: [https://aiic.vn/dinh-cu-canada-dien-tay-nghe/][1]

dinhcucanada #dinhcucanadadientaynghe #cachdinhcucanadadenhat #thexanhcanada #chiphidinhcucanada

ALLY - Đầu Tư và Định Cư Canada Add: Văn phòng 02, Tầng 08, Tòa nhà Pearl Plaza, 561A Điện Biên Phủ, P. 25, Q. Bình Thạnh, TP. HCM Phone: 02899989988

[1]: https://aiic.vn/dinh-cu-canada-dien-tay-nghe/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21