Sept. 19, 2022, 11:15 a.m. by rxsecureweb12
Biological Motivation
Valium is a moderately powerful drug that exerts its influence over the central nervous system. It is known for its muscle relaxant properties, although it also has anticonvulsant and antidepressants effects. The effects of the drug are caused by modulating the activity of neurotransmitters responsible for regulating many functions in the human body.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
