Sept. 17, 2022, 7:31 a.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời
Biological Motivation
Bạn rất cần chuyển tiền vào tài khoản điện thoại ngay lập tức nhưng không biết làm thế nào? Đừng lo lắng, bài viết dưới đây sẽ hướng dẫn cách chuyển tiền, bắn tiền của mạng VinaPhone dễ dàng và nhanh chóng. Hãy theo dõi để cùng thực hiện nhé! Nguồn (Source): https://vanhoadoisong.vn/wp-content/uploads/2022/05/2-cach-chuyen-tien-ban-tien-mang-vinaphone-don-gian-nhanh-chong.jpg
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21