Suggested problems

Order Alprazolam Online Overnight Delivery | Trusted Pharmacy

Sept. 15, 2022, 7:23 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Alprazolam is prescribed to treat anxiety and panic disorders. It is a part of a class of medications called benzodiazepine, which enhances the effect of a neurotransmitter GABA which blocks nerve impulses and reduces the over-activity in the brain, reducing symptoms of anxiety and panic. Some side effects of Alprazolam are dizziness, drowsiness, change in sex drive, and increased saliva production. It would be best to avoid alcohol as it can aggravate your side effects. You can have Alprazolam orally with or without food. The maximum dosage for anxiety disorder and panic disorder is 4mg and 10mg a day, respectively,

https://trustedpharmacy247.com/product-category/buy-xanax-online/

https://trustedpharmacy247.com/product-category/buy-alprazolam-online/

https://trustedpharmacy247.com/product/alprazolam-2mg/

https://trustedpharmacy247.com/product/alprazolam-1mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21