Suggested problems

Order Blue Xanax Bar Overnight Delivery | Trusted Pharmacy

Sept. 15, 2022, 6:40 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

A Blue Xanax bar is a rectangular cuboid pill with the inscription of “B707”. It has 2mg active alprazolam and is prescribed to treat anxiety and panic disorders. Xanax is a benzodiazepine that enhances the effects of a naturally occurring chemical in the brain, decreasing overactivity in the brain and reducing symptoms of anxiety and panic. The common side effects are dizziness, drowsiness, and a change in sex drive. Blue Xanax Bar is orally administered and can be had with or without food as directed by your physician. The maximum dosages for anxiety and panic disorder are 4mg and 10mg daily.

https://trustedpharmacy247.com/product-category/blue-xanax-bars/

https://trustedpharmacy247.com/product/blue-xanax-bars-2mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21