Suggested problems

Biological Motivation

tentang kami https://www.infopencaker.xyz">infopencaker.xyz merupakan website yang menyajikan informasi-informasi lowongan kerja terbaru. Dengan adanya blog ini dapat memberikan kemudahan bagi para pencari kerja yang ingin mendapatkan pekerjaan yang diinginkan.

terima kasih telah berkunjung ke https://www.infopencaker.xyz/">infopencaker silahkan berkunjung kembali.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21