Suggested problems

Biological Motivation

If you want to drive to a lot of locations but are blind on the road, or if you need to go to a lot of places but don't know which direction to go, go to my website right away. [Mapquest driving directions][1] will certainly satisfy you, and they can help you.

[1]: https://mapdriving-directions.info

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21