Suggested problems

Order Ambien Online Overnight Delivery | Trusted Pharmacy

Sept. 14, 2022, 9:07 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Ambien is prescribed to treat the sleeping disorder insomnia, where you may have trouble falling or staying asleep. If you have been diagnosed with insomnia, you can Buy Ambien Online. It is classified as a sedative and a hypnotic. It decreases sleep initiation by 20 minutes and helps you fall asleep faster to get better rest.

https://trustedpharmacy247.com/product-category/buy-ambien-online/

https://uswebmedicals.com/product-category/buy-ambien-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21