Suggested problems

Order Valium Online Overnight Delivery | Rx Secure Web

Sept. 13, 2022, 3:38 p.m. by rxsecureweb12

Biological Motivation

Valium (diazepam) is a benzodiazepine anticonvulsant medication that is primarily used as a sedative, muscle relaxant, and anticonvulsant. Valium is a sedative/hypnotic medication. Many people enjoy it because it makes them tired, relaxed, and sleepy. It is also very easy to find and much less expensive than other drugs. This medication guide and use instructions are for Valium (diazepam) and are valid for the following conditions: anxiety disorders and anxiety; muscle spasms; seizures; alcohol withdrawal symptoms. Please read this guide before using Valium. Take Valium by mouth with or without food. Do not chew, break, or open the capsule. Swallow it whole with water or other liquid. Do not drink grapefruit juice while taking Valium.

https://rxsecureweb.com/product-category/buy-valium-online/ https://rxsecureweb.com/product/valium-10mg/ https://rxsecureweb.com/product/valium-5mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21