Sept. 13, 2022, 12:16 p.m. by Max Wilson
Biological Motivation
Why do you need custom packaging for pies? Pie is a worldwide edible bakery product. Premium quality packaging is required to preserve the freshness and quality of baked items. An exclusive custom pie box designed in sturdy material keeps your items secure from external harm and grabs the attention of more customers as well.
But here raises the question of where you can get the best quality personalized [custom pie boxes][1]. The answer is ICustomBoxes. Our company is equipped with highly skilled designers who design pie box packaging in engaging ways. Furthermore, we use sustainable and eco-friendly stock in box production. You can customize your box in your desired size and shape.
Custom Pie Boxes in Multiple Styles:
Pie is a widely consumed dessert by each age group of people. Consumers get bored with the ordinary packaging of their favorite products. So, they get attracted by the innovative styles of boxes.
To give a charming presentation to products, we manufacture your boxes in various types, such as:
Mailer Box Sleeve Box Two-Piece Box Tuck-End Box Magnetic Box Pyramid Box
So, you can use all these styles of boxes for your packaging of pies. Moreover, you can add a window in all these boxes to make your products visually appealing. Besides, windows with PVC keep your bakery item safe and prevent dirt and germs.
Give Protection to Pie Box Packaging with Sustainable and Long-Lasting Material:
One of the main elements in custom packaging is the security of food products from external factors. We use the premium quality material that not only preserves your product but also gives your [cardboard pie slice boxes][2] an attractive appearance. We utilize the following type of material:
Eco-friendly kraft Sustainable Cardboard Corrugated Cardboard
Kraft and cardboard are safe for the environment and 100% eco-friendly. These boxes are the best option for packing bakery products. The climate-friendly and sturdy nature of these boxes keep pies secure from contaminations and maintain their natural taste for a longer time. Corrugated cardboard is used in shipping to ensure sensitive products during shipping.
Outshine your Pie Boxes with Delightful Coatings:
There are four types of coatings that I Custom Boxes employs to decorate your custom pie packaging. Coatings are used to give durability and secure packaging from scratches and stains. In coatings, we utilize these choices:
matte finish gloss lamination aqueous coating spot UV
Gloss lamination provides a shiny texture to the packaging surface. Compared to gloss, matte does not reflect light and gives a soft and velvety touch. Moreover, we also apply the aqueous coating as it is a water-based finish that secures packaging from smudges and is immune to fingerprints.
Decorate Your Custom Pie Boxes with Various Embellishments:
Plenty of embellishments are used to beautify pie packaging boxes. The best finishing option for a custom-printed pie box is ribbons. They make packaging more appealing and eye-catchy. Along with that, you can also make use of embossing and foil stamping. Embossing gives a three-dimensional impact to packaging and highlights writing. In contrast, foil stamping enriches your packaging. While windows cut out with PVC sheets provide the audience with a fantastic unboxing experience.
Avail of Our Top-Quality Services at Reasonable Costs:
One of the main characteristics of our company is that we provide high-quality services at reasonable prices. Even in printing or material choice, we always use premium quality options to make your packaging sturdy and enchanting.
What Makes ICustomBoxes Distinctive from Others? Why choose ICustomBoxes? How are we an ideal place for your [pie slice boxes wholesale][3] services? Providing high-quality and satisfactory customer services has made us the dominant packaging provider in the USA. These are some of the policies of our company that make us an ultimate choice for all your packaging needs: free and instant quote facility free and fast shipping service fastest turnaround time free of cost design assistance high-quality services at reasonable prices free design mock-ups discount offers on bulk orders availability of a customer service team around the clock
Reference: https://bit.ly/3DlN2qH
[1]: https://www.icustomboxes.com/pie-boxes/ [2]: https://www.icustomboxes.com/pie-boxes/ [3]: https://www.icustomboxes.com/pie-boxes/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
