Sept. 12, 2022, 6:32 p.m. by johnsmith9
Biological Motivation
In the past few years, SEO services near you might have used keyword plugging tools; however, with the evolving time, keyword research now requires more effort and time. The keyword research executed on the sites is now based on understanding the user intent. The keywords are now based on what a user might look for when searching for content.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
