Sept. 12, 2022, 10 a.m. by sedu
Biological Motivation
Teach your children to learn English at home and you have opened up a world of opportunities for their future. It is well documented that people who know English often earn more money, have the opportunity to get into top universities in the world and enjoy more travel opportunities, which is what most desired maturity.
TITTLE-1024x377
If you're determined to help your child learn English, you may be considering some form of expert guidance, whether that's through an online English course or finding a center. teacher specializing in children. But as a parent, you must be wondering, “What can I do at home to support my child's English learning?”. In the following article, we have compiled 10 expert tips on how to teach children to learn English at home for parents' reference.
- Sing English songs with children Some tutors have mentioned that music is a great way to get children's attention and help them remember new words without stress. Experts say that the best way is to sing and watch interactive videos. This has been tested and has given positive results so far. Most children love songs and can easily retain everything through music.
See More: [Learn English vocabulary by topic most effectively][1]
See More: [What is the difference between learning ielts and learning toeic?][2]
- Use English in daily life If you feel comfortable speaking English, use it in everyday life along with your mother tongue, i.e. bilingually speaking objects of everyday life with your child. Early exposure to more than one language at home has many benefits for children. Referring to a name of things in bilingual, studies show that it makes them easier to pronounce many words with different topics in the long run.
For professionals, make the learning process as natural as possible, don't treat English as a foreign language that must be learned, but include it in daily activities, games and songs as you do. with the child's native language. While coloring, name the colors in English, while dancing, repeat the names of the moves in English,...
Make a habit of studying regularly Children love routines, it evokes a sense of familiarity, security and helps them develop self-discipline, which is really helpful for second language learning. Expert advice for this learning method is this: if you're teaching your child to learn English at home , I recommend getting your child into a routine by establishing a consistent weekly, schedulable schedule. the date and time your child will learn English. Offer children suggestions to choose research topics to increase their interest in learning. Provide children with interesting jobs to do such as drawing the sun, map of Vietnam, images of animals, ... and record what they introduce, analyze, explain about that work, they will see I have grown up, respected by adults.
Play with your child in English Some of our tutors have suggested that you encourage your child to use English during play, which helps to learn a language that would not be the same as if they were having fun. Experts say, to help your child progress in learning English, let them play games in English like hide and seek, find objects, word puzzles and other popular games while speaking in English. Older brother.
Ask children to show something they see on TV On the topic of play, one idea for creative play is to have your child play an English-language movie trailer that you find on Youtube or TV. It is recommended that you ask your children to watch an advertisement and ask them to repeat what they see, as if they were filming a commercial. This helps their communication skills, if your child is a shy kid it will help them overcome their fear of making mistakes.
See also: [Methods of learning English for people who have lost their roots][3]
See More: [10 English songs for preschool children that are easy to memorize and fun][4]
- Read comic books with children If your child is a little older, comic books in English can be a great step towards learning English independently. Don't know where to start with which stories? Marvel Comics can also be a basic starting point for those who are learning American English, or Diary of Wimpy Kid is a great choice for teaching British English to children.
According to experts, comic books are a great way to motivate a child to learn English, depending on their age and ability. For example, if they read a comic book featuring their child's favorite superhero, they will enjoy learning. Also, pictures really help children understand language because they provide rich context.
- Give clever compliments to your child Children thrive on encouragement and, above all, parental encouragement, if your child is trying their best to learn English, let them know that their efforts make you proud.
Praise your child to create a sense of success and encourage them, especially as they continue to cope with difficult challenges. Create a reward system for when children work, study hard. No cost, extra free time, lots of visits with friends or outside activities of their choice. Do not criticize children often or examine every small mistake, it is normal to make mistakes when learning a foreign language, stay calm.
Ask your child with open-ended questions in English If your kids are under ten, they may always ask you “why?” Now it's your turn to do this to them. The strategy of classroom experts is to ask open-ended questions that allow students to speak and express themselves as much as possible. Parents can do the same, engaging their children in conversation, which allows them to use the language as much as possible.
Tea Party Game in English If your kids are very young, an English tea party with teddy bears is a very cute idea that they will enjoy. The best way for parents to help young children learn English at home combines learning with play. With young children, why not try organizing a tea party in English? children can offer their toys for parents to play with, perhaps with younger children who won't care what language is being spoken, as long as they can participate in pretend tea and cake sweet.
Create stories with them Creative writing in English is a fun activity for children with a rich imagination. With older children, try writing a story together. As an expert, it is advisable to create stories with the children about a toy they bring to the lesson. The child will then be involved in directing their learning from the outset. After the story is built, we take turns reading it aloud together. When children read the story again, they recognize the vocabulary, because these are the words they just told. Other keywords can also be added to make the story flow or to introduce new vocabulary. Later, use the story as a basis for homework assignments.
In short, give your children happy memories of learning English, and they will grow up with positive feelings towards this language. This will make them more likely to stick with it and develop their skills for fluency later on in the job. Children's creativity and excitement will help them succeed. Hopefully these tips have given you some inspiration to be creative in how to teach your children to learn English at home .
SEDU TRAINING CO., LTD Head office: No. 12, lane 248, Hoang Ngan Street, Trung Hoa Ward, Cau Giay, Hanoi Phone: 035 354 7680 Email: Phongnhansu.sedu@gmail.com Website: [http:// sedu.edu.vn][5]
[1]: https://sedu.edu.vn/hoc-tu-vung-tieng-anh-theo-chu-de-hieu-qua-nhat-342584 [2]: https://sedu.edu.vn/phuong-phap-hoc-tieng-anh-cho-nguoi-mat-goc-342587 [3]: https://sedu.edu.vn/phuong-phap-hoc-tieng-anh-cho-nguoi-mat-goc-342587 [4]: https://sedu.edu.vn/10-bai-hat-tieng-anh-cho-tre-mam-non-de-thuoc-va-vui-nhon-342588 [5]: http://sedu.edu.vn
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
