Biological Motivation

Do read my blog too it will really help you with content writing. we provide the Best Content Writing Courses in India. https://coursedekho.com/content-writing-courses-in-india/> Best Content Writing Courses in India

https://coursedekho.com/content-writing-courses-in-india/

digitalmarketing,#BestContentWritingCoursesinIndia,#iimskills

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21