Sept. 12, 2022, 9:33 a.m. by neharikagupta96
Biological Motivation
Do read my blog it will really help you with content writing. we provide the Best Content Writing Courses in India. https://coursedekho.com/content-writing-courses-in-india/> Best Content Writing Courses in India
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21