Suggested problems

Order Yellow Xanax Bars With Overnight Delivery | Trusted Pharmacy

Sept. 9, 2022, 10:37 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Yellow Xanax is typically packaged in a rectangular yellow pill that resembles a yellow school bus, hence the nickname. Yellow Xanax is the brand name for the prescription medicine Alprazolam, a benzodiazepine or "benzo," used to treat anxiety, insomnia, and panic disorders. Alprazolam is a central nervous system suppressant, which means it calms and sedates the body and mind. Yellow Xanax bars pills, like the other types and colors of Xanax, are generic alprazolam pills manufactured by Actavis Pharma. Buy Yellow Xanax Bars Online at our pharmacy and get 100% genuine and safe products at discount prices.

https://trustedpharmacy247.com/product-category/yellow-xanax-bars/

https://trustedpharmacy247.com/product/yellow-xanax-bars-2mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21