Suggested problems

Order Yellow Xanax Bars With Overnight Delivery | US WEB MEDICALS

Sept. 9, 2022, 10:29 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Yellow Xanax bars are the most well-known Xanax bar type. It comes in round, oval, curved, rectangular, and three-sided shapes with alprazolam strengths of 0.25 mg, 0.50 mg, 1 mg, and 2mg. These pills are commonly referred to as "school bus Xanax." Actavis Pharma manufactures the yellow alprazolam bars with the imprint R039. Buy Yellow Xanax Online from this website, and your order will be delivered to your door on time. Xanax is only safe to use when purely prescribed by a medical professional. When abused, Xanax can be highly addictive and even fatal.

https://uswebmedicals.com/product-category/yellow-xanax-bars/ https://uswebmedicals.com/product/yellow-xanax-bars/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21