Sept. 6, 2022, 7:59 p.m. by Tyler jones
Biological Motivation
Is Hotmail Support available 24x7? Yes, Hotmail Support is available 24x7 to all of their users. Hotmail is one of the world’s leading, prominent and resourceful email services, used by billions worldwide. It offers a consistent and dependable 24x7 customer care support that resolves queries of their customers. https://www.emailsupport-contact.net/hotmail-email/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
