Suggested problems

Buy Soma Online | Carisoprodol | Overnight Delivery | US WEB MEDICALS

Sept. 6, 2022, 9:25 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Soma is a muscle relaxant medication belonging to the skeletal muscle relaxants group. This medicine is used to treat patients with muscle pain and discomfort. Soma is used in conjunction with rest and physical therapy to treat skeletal muscle conditions such as pain or injury. Buy Soma Online from our pharmacy if you need to take it in an emergency. In the market, this medicine is sold under the generic name Carisoprodol. Everyone should use this medicine only for a short period of time as there is no proof of its long term effectiveness. Depending on a person's medical condition and how they respond to treatment, the dosage can vary from person to person. Avoid taking Soma in larger doses; continued use of Soma can be dangerous. Adult musculoskeletal disorders can be treated with Soma; anyone can easily Buy Soma Online from our website.

https://uswebmedicals.com/product-category/buy-soma-online/ https://www.linkedin.com/showcase/buy-soma-350mg-online-cheap

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21