Suggested problems

Buy Xanax Online Overnight Delivery | Us Meds Choice

Sept. 5, 2022, 4:34 p.m. by usmeds12

Biological Motivation

We all get anxious and nervous in some cases, such as when going on a first date, giving an interview, etc., if anxiety affects our daily life. If it prevents you from performing your daily activities, then you should buy Xanax online, as it is considered the best medication for anxiety management.

https://usmedschoice.com/product-category/buy-xanax-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21