Suggested problems

Buy Tramadol Online Overnight Delivery | Trusted Pharmacy

Sept. 3, 2022, 12:06 p.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Tramadol is an extremely effective analgesic. You can easily and affordably Buy Tramadol Online from our website. Ultram is the brand name for this medication. Tramadol is a synthetic opioid that alters how your body perceives and responds to pain by acting on opioid receptors in the nerves and brain. Tramadol is a pain medicine used to treat moderate to severe pain that other pain relievers cannot treat. Tramadol works in the central nervous system (brain and spine) to alleviate pain. Tramadol is taken orally in an immediate-release formulation; relief begins within an hour; injection is also available. Buy Tramadol online from our pharmacy and say goodbye to all kinds of pain you have.

https://trustedpharmacy247.com/product-category/buy-tramadol-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21