Suggested problems

Biological Motivation

You will want the professional services of an experienced AC installation Dubai business whether you are moving into a new home in Dubai or intend to replace your old AC unit with a new one. Our personnel is trained professionals with years of experience in [ac installation services dubai][1] and maintenance in Dubai services. Our goal is to offer all of our client's long-term solutions that perform better in terms of vitality so that you may save a lot of money on maintenance and electricity costs.

[1]: https://ogenerals.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21