Suggested problems

Buy Tramadol Online Overnight Delivery | US WEB MEDICALS

Sept. 2, 2022, 11:16 a.m. by Buy S 90 3 Green Xanax bars Online

Biological Motivation

Tramadol is a highly effective pain reliever to treat moderate to severe pain. The medication's active ingredients have an opioid-like effect on patients, reducing moderate to severe pain. Tramadol's immediate-release form has short-term effects, whereas Tramadol's extended-release form is useful for pain management around the clock. Buy Tramadol Online and consult with a medical professional. Check to see if the patients taking Tramadol have any restrictions or contraindications to the medication.

[1]: https://uswebmedicals.com/product-category/buy-tramadol-online/ [2]: https://uswebmedicals.com/product/tramadol-100mg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21