Suggested problems

Biological Motivation

Yes, [Cogeco Email Customer Service][1] provides the facility of a live chat to its users. If users prefer text messaging to calling, they can chat with a live agent to handle most requests, including booking installations, making changes to their account, and troubleshooting service issues.

[1]: https://www.emailsupport-contact.net/cogeco-email/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21