Suggested problems

top iv drips in dubai

Aug. 29, 2022, 1:16 p.m. by canyamen

Biological Motivation

A novel approach to provide the body with nutrients in the form of vitamins, minerals, amino acids and antioxidants. SKIN111 now [iv drip dubai][1] which supports you to recover faster by enhancing your metabolic status and offers a sense of well-being. Thus by utilizing iv drip in dubai, we ensure that 100% of the constituents are absorbed and utilized by the body. These supplements are administered directly into the bloodstream, making nutrients available for immediate use. There is minimal waste because vitamins and medications are delivered directly to the cells that need them. Book your appointment now at SKIN111 and try our IV drip dubai.

[1]: https://healthcall.ae

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21