Suggested problems

Buy research chemicals online: https://dmtforsale.us/

Aug. 29, 2022, 1:05 p.m. by stevemeds

Biological Motivation

We have years of experience in this industry and have built up the reputation as one of the most trusted suppliers in the UK, Europe and worldwide. We appreciate that there are many different options available to you for sourcing your Medication, so please take a minute to read what sets us apart from the rest.

We maintain the highest of standards, not only in the production of our own products, but also in the selection of all products we add to our range. We offer the most reliable operation and sell at very affordable prices. We ship worldwide and offer one of the best services discreet delivery to our customer's address. Please request a quote.

By emailing us via …… ordermcatonline@gmail.com Whatsapp……. +31645084874 Or visit of websites either through one of the links below:

Buy research chemicals online: https://dmtforsale.us/

buy mephedrone, Buy Mephedrone online, Buy Mephedrone plant food, Mephedrone for sale, MKAT for sale, 4MMC for sale,

Buy research chemicals online: https://dmtforsale.us/

Amphetamine powder for sale: https://dmtforsale.us/product/amphetamine-powder-for-sale/

Buy fentanyl powder: https://dmtforsale.us/product/buy-fentanyl-powder/

Buy GHB online: https://dmtforsale.us/product/buy-ghb-online/

Buy JWH 250 online: https://dmtforsale.us/product/buy-jwh-250-online/

Buy Mephedrone online: https://dmtforsale.us/product/buy-mephedrone-4-mmc/

Buy butylone powder: https://dmtforsale.us/product/butylone/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21