Aug. 29, 2022, 9:43 a.m. by sid2901singh
Biological Motivation
Many men all across the world in the age group of 18-65 years face a problem called Erectile Dysfunction. Erectile Dysfunction can be defined as the inability of a man to gain or sustain a penile erection long enough for a satisfactory experience on bed.
There are various treatment options available some of which are exercises, herbal treatment, yoga, medications. For instant curing options, doctors mostly recommend to go for medications.
The most commonly used medications contain Sildenafil Citrate or Tadalafil or sometimes even both as their active components. These components help in curing ED problems in men.
Cenforce 100, Cenforce 150, Cenforce 200, Kamagra 100mg, Malegra 200, and Aurogra 100 are the most popular medicines that contains Sildenafil Citrate as their active component.
Vidalista 60, Vidalista 40, and Vidalista are the most popular medicines that contain Tadalafil as their active component.
All generic medicines are available on the most trusted online pharmacy in USA – AllDayPlus.com.
Buy the best quality medicines from AllDayPlus at cheap and affordable prices.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21