Suggested problems

Biological Motivation

Cenforce 100 is a medicine that is used for the treatment of Erectile Dysfunction problems in men. It contains Sildenafil Citrate as its active component in a strength of 100mg. Buy Cenforce 100 from the best online pharmacy – AllDayPlus.com.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21