Aug. 24, 2022, 4:18 p.m. by Gowtham50
Biological Motivation
Our company Sign Vision is an Ahmedabad-based startup working towards the betterment of deaf people by imparting them skills in Indian Sign Language which will help them to get jobs and to live a good life.
The founder of Sign Vision is Mr. Karan Shah who is deaf. Mr. Shah has done graduation with a B.A with specialization in Computer Science. Mr. Shah has done his schooling in a deaf school. After completing higher education when Mr. Shah went to college for studying B.A. and he was very worried after knowing that no one was able to understand sign language. So he thought about how to communicate with fellow students and faculties.
The same difficulty is faced by every deaf child if they go to a normal school or college. Deaf people cannot understand what is being taught to normal people by normal faculties. Hence there is no accessibility to them. Since these difficulties are faced by every deaf student, they are not able to study in college and cannot get a good education. As a result, they do not get a good job and they face difficulties in living the good life.
Mr. Shah believes that every deaf individual has the right to learn and should have accessibility. Hence Mr. Shah decided to start a company called Sign Vision which will create job-oriented courses in Indian Sign Language for the deaf community. Mr. Shah thought that if deaf people can teach job-oriented courses to deaf people in Indian Sign Language, then they will be able to get jobs and will be able to live a good life.
Mr. Shah is truly grateful to provide his time and financial support for this project. Furthermore, he looks forward to the collective support from the students, teachers, parents, professionals, entrepreneurs, and yourself for a better life for deaf people.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
