Biological Motivation

Clipping Path Us is a dedicated clipping path service provider managed by some professional and experienced graphic designers. Our buyers have a good knowledge of our photo editing services and recognize it as one of the best crop path service companies in the world. Clipping Path Service Inc is a model image editing platform. Our clients have benefited their business by using our high quality, professional and affordable Photoshop services. We have more than 150 Photoshop experts to provide all types of image editing tasks. We reportedly provide cropping path, color correction, image masking, neck join, photo retouching, background removal and e-commerce image editing services worldwide. We believe that our clients' success means our success. That is why we are committed to providing high quality work. Clipping Path is an excellent choice for a high quality background removal service from Clipping Path Us. As today's preferred clipping path service provider in Southeast Asia, we provide all types of clipping path services at the lowest price, whether it's image background removal or multi-color correction. So you can rely on us when it comes to road cutting service [more information][1]

clippingpath #clippingpathservice #backgroundremoval #imagemasking #dropshadowservice #reflectionshadowservice #photoretouchingservice #colorcorrectionservice #ecommerceimageediting #carimageediting #neckjointservice #ghostmannequinservice #invisiblemannequinservice #removefromimage #whitebackgroundremove #photocutout #imageediting #photomanipulation

[1]: https://www.clippingpathservice.us/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21