Suggested problems

Biological Motivation

[Peacocktv.com/tv][1]To activate Peacock TV, visit https://www.peacock-comtv.com/ and enter the activation code you get from your device. The application installed on your device restarts and you'll be able to be granted the access to peacock streaming.

[1]: https://www.peacock-comtv.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21