Suggested problems

Professional Courses after 12th Commerce

Aug. 16, 2022, 7:14 a.m. by neharikagupta984

Biological Motivation

looking for Professional Courses after 12th Commerce join us we have great teachers and all kinds of courses you will need to have a thriving career in the world of business. Do read this blog it will help u understand better https://iimskills.com/professional-courses-after-12th-commerce/> Professional Courses after 12th Commerce

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21