Suggested problems

Camping Fan with LED Lantern, 20000mAh Rechargeable Battery Operated Outdoor Tent Fan

Aug. 8, 2022, 7:23 a.m. by ipanergy

Biological Motivation

【20000mAh RECHARGEABLE BATTERY】 Powered by a 20000mAh rechargeable battery, it can be fully charged in 8-9 hours with 5V3A input via the including type-C cord, and provide 8-100hours duration. Built-in 5V/3A Type-C input/output port and a 5V/2A USB output port for charging the fan conveniently, or using it as a power bank to power other devices, a good helper for camping trips, power outages, hurricanes, etc. 【SUPER BRIGHT LED LIGHT】 Composed of 16 LED light beads with 3 brightness settings, and provides the ideal light source for nighttime outdoor activities, like barbecues, picnics, hiking, and fishing, etc. 【DOUBLE TRI BLADE & 270° PIVOT】 The camping fan with a double tri-blade design puts on more powerful airflow than the ordinary others. Plus 4 different speeds to meet your different demands. A 270° pivoting head enables you to cool you down instantly in whichever direction you like. more fan ipanergy.com ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21