Suggested problems

Biological Motivation

Outsourcing services to competent individuals have many benefits. They'll complete their assignment in time. They will offer expensive and elevated services. Not all service providers are costly; some offer good quality for a decent price. They provide a wide range of services.

AC Maintenance [O General Ac Installation][1] AC ducting Chiller maintenance palm Split AC service.

[1]: https://dcsaleshop.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21