Aug. 5, 2022, 2:02 a.m. by NedPadberg
Biological Motivation
blockpost is a new free-to-play first-person shooter game that can be played on mobile devices as well as desktop PCs. This game is a great illustration of how the first-person shooter (FPS) genre can coexist with cubic 3D game graphics. You will engage in heated online battles with people from all over the world. Select your weapon, then join the match, and you'll never get tired with Blockpost because it has seven different game types and more than twenty different maps to choose from. Furthermore, Blockpost will provide you the ability to upgrade and unlock over a hundred different sorts of guns. The more you play, the faster you will level up and gain access to new weapons and stuff. Inviting your friends to play this game with you is a terrific method to boost your chances of winning.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
