Suggested problems

Biological Motivation

Buy Crystal Meth Online in the USA. Crystal mеth iѕ the common name fоr сrуѕtаl methamphetamine, a ѕtrоng аnd highly addictive drug that affects the central nеrvоuѕ ѕуѕtеm. [Meth for sale, buy meth online, buy crystal meth online, buy methamphetamine online, crystal meth online, buy crystal meth, order meth online][1]

https://www.researchchemslab.com/product/buy-meth-online/

[1]: https://www.researchchemslab.com/product/buy-meth-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21