Suggested problems

Biological Motivation

[Ivermectin][1] is a medication used to treat a variety of parasitic infections. These include head lice, scabies, river blindness, and strongyloides stercoralis. Ivermectin works by causing paralysis in the parasites, which leads to their death. The FDA has approved ivermectin for use in humans, and it is available as a cream, lotion, or pill.

[1]: http://buyivermectin24.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21