Suggested problems

Need to know the most recent Dell Printer models?

July 26, 2022, 3:41 p.m. by Hanry Mark

Biological Motivation

Might it at any point be said that you are planning to buy a printer for your office or home? Have you shortlisted any of the printers open watching out? If not, then, our gathering of mechanised promoting has simplified it for you to pick one. Our site has been invigorated with the latest variations of [Dell Printer models][1] with their momentous features.

[1]: https://www.printerssupportpro.com/dell-printer/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21