Suggested problems

15 Weird Ways To Increase Your Keto Super Burn Gummies

July 22, 2022, 11:05 a.m. by jaiminkarlo

Biological Motivation

Official Website@>> https://wellnesscare24x7.com/keto-super-burn-gummies/

Keto Super Burn Gummies => Keto Super Burn Gummies will make impacts that are all very advantageous and virtually will prove to be the only great technique that you want and to lose weight thru the shorter course no different pill may be as powerful. Each benefit you could have had constantly wished for will be now turned into a fact and also you shall be in an high-quality position concerning a narrow body. Get keep of the product right now so you be slim and entire your weight loss.

Related Posts:

https://www.facebook.com/KetoSuperBurnGummies/ https://www.facebook.com/KetoSuperBurn/ https://www.outlookindia.com/outlook-spotlight/via-keto-apple-gummies-australia-chemist-warehouse-weight-loss-apple-keto-gummies-au-exposed-2022-fake-or-real--news-205554 https://www.outlookindia.com/outlook-spotlight/via-keto-gummies-australia-reviews-viaketo-gummies-au-nz-chemist-warehouse-keto-does-it-really-work--news-208360

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21