Suggested problems

Total Health ACV+Keto Gummies

July 19, 2022, 7:23 a.m. by obertsnally

Biological Motivation

Total Health ACV+Keto Gummies This manual is designed to inform you approximately Total Health ACV+Keto Gummies, the powerful treatment for weight reduction. These are particularly designed for the ones who've obese our bodies or unhappy with present day frame weight. Read extra to find out how those keto gummies assist to burn fat, and assist readers to acquire the consequences they preference. https://www.outlookindia.com/outlook-spotlight/total-health-acv-keto-gummies-scam-warning-alert-shocking-simply-health-acv-keto-gummies-news-revealed--news-210025 https://www.outlookindia.com/outlook-spotlight/ez-burn-keto-gummies-ez-burn-keto-gummies-pills-scam-or-real-weight-loss-results-news-210024

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21