Suggested problems

How to relaxing

July 19, 2022, 2:32 a.m. by victorkramer

How to relaxing

[Heardle Game][1] has a well-known song structure and a range of musical styles, from classical to current. Additionally, to prevent boredom, the songs that play in this game are logically constructed and the majority of them include a variety of rhythms, from soothing to exhilarating. If you enjoy music and have a large and varied personal music collection, you can demonstrate that you are the game winner through skill rather than luck. You can use appealing visual cues in this game in addition to listening to each track to make your guesses. You can play itwith friends and coworkers to make it more difficult.

If you've never played Heardle Game before, don't panic. Here are some simple rules to help you get started: You'll hear the opening second of a fairly well-known song to begin the game. Next, if you already know the answer, guess the name of the artist and the song's title; otherwise, move on to the next person. You will hear a little bit more of the song's melody when you skip or make a bad guess. The last guess plays the entire 16 seconds of the quiz's tune, and the game continues until the sixth attempt.

[1]: https://heardlegame.io/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21