Suggested problems

Website Designing in Agra

July 18, 2022, 5:37 p.m. by keshavdev695

Biological Motivation

We Provided Software Maintenance same to same Website Maintenance. KD Software Pvt. Ltd. has been designing cost effective web sites for your businesses and organizations. We produce user-friendly websites, using the latest technologies. [Website Designing in Agra][1] [Website Design in Agra][2] [Website Designing company in agra][3] [Website Designing in Agra][4]

[1]: https://kdsoftware.in/ [2]: https://kdsoftware.in/ [3]: https://kdsoftware.in/ [4]: https://kdsoftware.in/website-designing

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21