Suggested problems

Dịch vụ kiểm nghiệm, kiểm định

July 15, 2022, 8:02 a.m. by Sài Gòn Xuân Phát

Biological Motivation

Công ty Giải pháp Trí Việt chuyên cung cấp dịch vụ [kiểm nghiệm, kiểm định][1]. Trong đó có kiểm nghiệm sản phẩm, kiểm định thiết bị và huấn luyện an toàn lao động. Việc kiểm nghiệm sản phẩm, kiểm định thiết bị là điều kiện bắt buộc đối với các doanh nghiệp, công ty trong lĩnh vực hoạt động của mình. Nó sẽ giúp công ty kiểm soát chất lượng sản phẩm đầu ra, đáp ứng các tiêu chuẩn do pháp luật quy định, nâng cao uy tín của công ty đối với người tiêu dùng và khách hàng.

[1]: https://giaiphaptriviet.com/dich-vu-kiem-nghiem-kiem-dinh/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21